RSV-Flag-Brd3
(Plasmid
#86615)
-
PurposeFlag tagged mouse Brd3 expression construct for cell transfection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAdRSV-Sp-Flag
-
Backbone manufacturerPMID: 12490204
- Backbone size w/o insert (bp) 4260
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrd3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2204
-
Entrez GeneBrd3 (a.k.a. 2410084F24Rik, AW060456, Fsrg2, ORFX, RINGL3)
- Promoter RSV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI-klenow (destroyed during cloning)
- 3′ cloning site EcoRI-klenow (destroyed during cloning)
- 5′ sequencing primer CCTCAGTGGATGTTGCCTTTAC
- 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RSV-Flag-Brd3 was a gift from Mario García-Domínguez (Addgene plasmid # 86615 ; http://n2t.net/addgene:86615 ; RRID:Addgene_86615) -
For your References section:
Association of bromodomain BET proteins with chromatin requires dimerization through the conserved motif B. Garcia-Gutierrez P, Mundi M, Garcia-Dominguez M. J Cell Sci. 2012 Aug 1;125(Pt 15):3671-80. Epub 2012 May 17. 10.1242/jcs.105841 PubMed 22595521