-
Purposeexpression of shRNA targeting PTEN
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86645 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSuper
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePTEN
-
gRNA/shRNA sequenceGGCACAAGAGGCCCTAGATT
-
SpeciesH. sapiens (human)
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
- Promoter H1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PTEN shRNA was a gift from Jaime Modiano (Addgene plasmid # 86645 ; http://n2t.net/addgene:86645 ; RRID:Addgene_86645) -
For your References section:
Attenuation of PTEN increases p21 stability and cytosolic localization in kidney cancer cells: a potential mechanism of apoptosis resistance. Lin PY, Fosmire SP, Park SH, Park JY, Baksh S, Modiano JF, Weiss RH. Mol Cancer. 2007 Feb 14;6:16. 10.1186/1476-4598-6-16 PubMed 17300726