Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PTEN shRNA
(Plasmid #86645)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86645 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSuper
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PTEN
  • gRNA/shRNA sequence
    GGCACAAGAGGCCCTAGATT
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
  • Promoter H1

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PTEN shRNA was a gift from Jaime Modiano (Addgene plasmid # 86645 ; http://n2t.net/addgene:86645 ; RRID:Addgene_86645)
  • For your References section:

    Attenuation of PTEN increases p21 stability and cytosolic localization in kidney cancer cells: a potential mechanism of apoptosis resistance. Lin PY, Fosmire SP, Park SH, Park JY, Baksh S, Modiano JF, Weiss RH. Mol Cancer. 2007 Feb 14;6:16. 10.1186/1476-4598-6-16 PubMed 17300726