Skip to main content

pAAV-Puro_siKO-2TO
(Plasmid #86697)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86697 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-Puro_siKO
  • Backbone manufacturer
    Ludovic Vallier
  • Backbone size (bp) 9585
  • Modifications to backbone
    Removed H1 TO and gRNA scaffold by digestion with BstBI and HincII. Replaced with a 2TO H1 promoter and gRNA scaffold.
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter H1 2TO
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGAACGCTGACGTCATCAACC
  • 3′ sequencing primer GGGCTATGAACTAATGACCCCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    H1-TO promoter taken from pSuperior Neo (oligoengine)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Puro_siKO-2TO was a gift from Ludovic Vallier (Addgene plasmid # 86697 ; http://n2t.net/addgene:86697 ; RRID:Addgene_86697)
  • For your References section:

    Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Bertero A, Pawlowski M, Ortmann D, Snijders K, Yiangou L, Cardoso de Brito M, Brown S, Bernard WG, Cooper JD, Giacomelli E, Gambardella L, Hannan NR, Iyer D, Sampaziotis F, Serrano F, Zonneveld MC, Sinha S, Kotter M, Vallier L. Development. 2016 Dec 1;143(23):4405-4418. 10.1242/dev.138081 PubMed 27899508