Skip to main content

ER-GCaMP6-150
(Plasmid #86918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86918 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FCK(1.3)GW
  • Backbone size w/o insert (bp) 9246
  • Total vector size (bp) 10698
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ER-GCaMP6-150
  • Species
    Synthetic
  • Insert Size (bp)
    1452
  • Mutation
    K78H, T302L, R303P, A317E, D324G, D360G, D380Y, T381R, S383T, R392G in GCaMP3
  • Promoter CAMKII

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgactgagaccctcccacccgtg actgaaagcgccgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-GCaMP6-150 was a gift from Timothy Ryan (Addgene plasmid # 86918 ; http://n2t.net/addgene:86918 ; RRID:Addgene_86918)
  • For your References section:

    Axonal Endoplasmic Reticulum Ca2+ Content Controls Release Probability in CNS Nerve Terminals. de Juan-Sanz J, Holt GT, Schreiter ER, de Juan F, Kim DS, Ryan TA. Neuron. 2017 Jan 30. pii: S0896-6273(17)30034-X. doi: 10.1016/j.neuron.2017.01.010. 10.1016/j.neuron.2017.01.010 PubMed 28162809