Skip to main content

pET mRuby2 LIC cloning vector (u-mRuby2)
(Plasmid #86932)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86932 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 5475
  • Modifications to backbone
    mRuby2 is from AddGene plasmid 49089.
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 Forward
  • 3′ sequencing primer T7 Reverse
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The sequence for mRuby2 came from Addgene #49089 (pcDNA3.1-Clover-mRuby2).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TTTAAGAAGGAGATATAGATC3'

Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'

The ORF inserted into this plasmid MUST begin with ATG. Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with EcoRV, then gel purify.

When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET mRuby2 LIC cloning vector (u-mRuby2) was a gift from Chris Jeans (Addgene plasmid # 86932 ; http://n2t.net/addgene:86932 ; RRID:Addgene_86932)