HS-H3-GFP
(Plasmid
#8698)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonena
- Backbone size w/o insert (bp) 10200
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH3
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)420
-
Entrez GeneHis3:CG31613 (a.k.a. Dmel_CG31613, CG31613, Dmel\CG31613, His3)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EagI (not destroyed)
- 5′ sequencing primer na
- 3′ sequencing primer CCATCTAATTCAACAAGAATTGGGACAAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Heat shock promoter. Ahmad lab #k90.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HS-H3-GFP was a gift from Kami Ahmad (Addgene plasmid # 8698 ; http://n2t.net/addgene:8698 ; RRID:Addgene_8698) -
For your References section:
The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Ahmad K, Henikoff S. Mol Cell 2002 Jun;9(6):1191-200. 10.1016/S1097-2765(02)00542-7 PubMed 12086617