pJB172
(Plasmid
#86992)
-
PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJB166
-
Backbone manufacturerJulien Berro
- Backbone size w/o insert (bp) 11528
- Total vector size (bp) 11514
-
Modifications to backboneBackbone amplified with 2 couples of primers containing annealing tails. Both PCR products used to created pJB172 via Gibson cloning
-
Vector typeYeast Expression
-
Selectable markersFluoride
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting pil1
-
gRNA/shRNA sequenceGGACGGCGGTTTGCTGAGGA
-
SpeciesS. pombe (fission yeast)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer JB330
- 3′ sequencing primer JB331 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid to be used with the strains JB224 or JB300 created by the Berro lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB172 was a gift from Julien Berro (Addgene plasmid # 86992 ; http://n2t.net/addgene:86992 ; RRID:Addgene_86992) -
For your References section:
Use of a fluoride channel as a new selection marker for fission yeast plasmids and application to fast genome editing with CRISPR/Cas9. Fernandez R, Berro J. Yeast. 2016 Oct;33(10):549-557. doi: 10.1002/yea.3178. Epub 2016 Sep 7. 10.1002/yea.3178 PubMed 27327046