Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJB172
(Plasmid #86992)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86992 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJB166
  • Backbone manufacturer
    Julien Berro
  • Backbone size w/o insert (bp) 11528
  • Total vector size (bp) 11514
  • Modifications to backbone
    Backbone amplified with 2 couples of primers containing annealing tails. Both PCR products used to created pJB172 via Gibson cloning
  • Vector type
    Yeast Expression
  • Selectable markers
    Fluoride

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting pil1
  • gRNA/shRNA sequence
    GGACGGCGGTTTGCTGAGGA
  • Species
    S. pombe (fission yeast)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid to be used with the strains JB224 or JB300 created by the Berro lab

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB172 was a gift from Julien Berro (Addgene plasmid # 86992 ; http://n2t.net/addgene:86992 ; RRID:Addgene_86992)
  • For your References section:

    Use of a fluoride channel as a new selection marker for fission yeast plasmids and application to fast genome editing with CRISPR/Cas9. Fernandez R, Berro J. Yeast. 2016 Oct;33(10):549-557. doi: 10.1002/yea.3178. Epub 2016 Sep 7. 10.1002/yea.3178 PubMed 27327046