Skip to main content

pCMV4-ApoE4
(Plasmid #87087)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87087 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV4
  • Backbone size w/o insert (bp) 5039
  • Total vector size (bp) 5992
  • Vector type
    Mammalian Expression
  • Selectable markers
    unknown

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Try following protocols for low copy plasmids if bacterial culture grow slowly.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Apolipoprotein E4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    953
  • GenBank ID
    NG_007084.2
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCATTGACGTCAATGGGAGTTTG
  • 3′ sequencing primer GGCACTGGAGTGGCAACTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the plasmid used in the reference is in AAV backbone. the plasmid deposit here is not in AAV backbone

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4-ApoE4 was a gift from Bradley Hyman (Addgene plasmid # 87087 ; http://n2t.net/addgene:87087 ; RRID:Addgene_87087)
  • For your References section:

    Gene transfer of human Apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000. 10.1126/scitranslmed.3007000 PubMed 24259049