Skip to main content

pCASCADE-gapAP1
(Plasmid #87146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87146 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCASCADE
  • Backbone manufacturer
    None - Constructed in House
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 2903
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    gapAP1 guide array
  • gRNA/shRNA sequence
    1 Guide Array : E . coli gapA gene promoter 1
  • Promoter E . coli ugpB gene promoter, low phosphate induction

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCACGTCGTCCCTATCTG
  • 3′ sequencing primer ATCTCCGCCCCGTTCGTAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCASCADE-gapAP1 was a gift from Michael Lynch (Addgene plasmid # 87146 ; http://n2t.net/addgene:87146 ; RRID:Addgene_87146)