Skip to main content

pEGFP-C1-ADRP
(Plasmid #87161)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87161 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 6053
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADRP
  • Alt name
    PLIN2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1314
  • GenBank ID
    BC005127.2
  • Entrez Gene
    PLIN2 (a.k.a. ADFP, ADRP)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer EGFP-C-F catggtcctgctggagttcgtg
  • 3′ sequencing primer EGFP-C-R gttcagggggaggtgtg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ADRP cDNA from Open Biosystems (Clone ID:3844174)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was generated by Simon Pfisterer (Elina Ikonen Lab).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-ADRP was a gift from Elina Ikonen (Addgene plasmid # 87161 ; http://n2t.net/addgene:87161 ; RRID:Addgene_87161)
  • For your References section:

    Seipin regulates ER-lipid droplet contacts and cargo delivery. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre J, Thiele C, Holtta-Vuori M, Jokitalo E, Ikonen E. EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22. 10.15252/embj.201695170 PubMed 27879284