-
PurposeFluorescent protein localized to lipid droplets (LDs)
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki
Located in Finland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87161-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87161-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6053
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADRP
-
Alt namePLIN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1314
-
GenBank IDBC005127.2
-
Entrez GenePLIN2 (a.k.a. ADFP, ADRP)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer EGFP-C-F catggtcctgctggagttcgtg
- 3′ sequencing primer EGFP-C-R gttcagggggaggtgtg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byADRP cDNA from Open Biosystems (Clone ID:3844174)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was generated by Simon Pfisterer (Elina Ikonen Lab).
DNA (Catalog # 87161-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87161-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-ADRP was a gift from Elina Ikonen (Addgene plasmid # 87161 ; http://n2t.net/addgene:87161 ; RRID:Addgene_87161) -
For your References section:
Seipin regulates ER-lipid droplet contacts and cargo delivery. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre J, Thiele C, Holtta-Vuori M, Jokitalo E, Ikonen E. EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22. 10.15252/embj.201695170 PubMed 27879284