Skip to main content

AP1297‐1
(Plasmid #87247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4400

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1200
  • Tag / Fusion Protein
    • gtbp‐1 (flanking sequence)::eGFP::gtbp‐1 (27bp)::PH::gtbp‐ 1 (flanking sequence)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgctgcaaggcgattaagttgg
  • 3′ sequencing primer ctttatgcttccggctcgtatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AP1297‐1 was a gift from Geraldine Seydoux (Addgene plasmid # 87247 ; http://n2t.net/addgene:87247 ; RRID:Addgene_87247)
  • For your References section:

    Cas9-assisted recombineering in C. elegans: genome editing using in vivo assembly of linear DNAs. Paix A, Schmidt H, Seydoux G. Nucleic Acids Res. 2016 Sep 6;44(15):e128. doi: 10.1093/nar/gkw502. Epub 2016 Jun 1. 10.1093/nar/gkw502 PubMed 27257074