Skip to main content

P628_SpCas9-RecA
(Plasmid #87263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87263 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX459
  • Backbone size w/o insert (bp) 8512
  • Total vector size (bp) 9613
  • Modifications to backbone
    Human codon optimized RecA coding sequencing was inserted into the pSpCas9(BB)-2A-Puro (PX459) vector via the EcoRI cloning site.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RecA
  • Species
    Synthetic; E.Coli
  • Insert Size (bp)
    1101
  • Mutation
    no
  • Promoter CBh
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGCTGGACGCCACCCTGATC
  • 3′ sequencing primer AACAGATGGCTGGCAACTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P628_SpCas9-RecA was a gift from Yonglun Luo (Addgene plasmid # 87263 ; http://n2t.net/addgene:87263 ; RRID:Addgene_87263)
  • For your References section:

    Fusion of SpCas9 to E. coli Rec A protein enhances CRISPR-Cas9 mediated gene knockout in mammalian cells. Lin L, Petersen TS, Jensen KT, Bolund L, Kuhn R, Luo Y. J Biotechnol. 2017 Mar 1;247:42-49. doi: 10.1016/j.jbiotec.2017.02.024. 10.1016/j.jbiotec.2017.02.024 PubMed 28259533