Skip to main content

pUC19-Top-Toehold-mCherry
(Plasmid #87318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87318 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 3668
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Split-Broccoli "Top" transcript upstream of an RNA Toehold (TS2_KS01) controlling mCherry translation.
  • Species
    Synthetic
  • Insert Size (bp)
    987
  • Promoter P70a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer GCTATGACCATGATTACGCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-Top-Toehold-mCherry was a gift from Donald Burke (Addgene plasmid # 87318 ; http://n2t.net/addgene:87318 ; RRID:Addgene_87318)
  • For your References section:

    A Fluorescent Split Aptamer for Visualizing RNA-RNA Assembly In Vivo. Alam KK, Tawiah KD, Lichte MF, Porciani D, Burke DH. ACS Synth Biol. 2017 May 26. doi: 10.1021/acssynbio.7b00059. 10.1021/acssynbio.7b00059 PubMed 28548488