-
PurposeMammalian expression vector encoding Histone 2B GFP fusion and miniSOG2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemini singlet oxygen generator 2
-
Alt nameminiSOG2
-
Insert Size (bp)318
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_miniSOG2 T2A H2B-EGFP was a gift from Xiaokun Shu (Addgene plasmid # 87410 ; http://n2t.net/addgene:87410 ; RRID:Addgene_87410) -
For your References section:
Precision Optogenetic Tool for Selective Single- and Multiple-Cell Ablation in a Live Animal Model System. Makhijani K, To TL, Ruiz-Gonzalez R, Lafaye C, Royant A, Shu X. Cell Chem Biol. 2017 Jan 19;24(1):110-119. doi: 10.1016/j.chembiol.2016.12.010. Epub 2017 Jan 5. 10.1016/j.chembiol.2016.12.010 PubMed 28065655