Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pIHEU_miniSOG2 T2A H3.3A-EGFP
(Plasmid #87411)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87411 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mini singlet oxygen generator 2
  • Alt name
    miniSOG2
  • Insert Size (bp)
    318

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer aattgtgctcggcaacagc
  • 3′ sequencing primer ggcgcacagaaatgattacaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIHEU_miniSOG2 T2A H3.3A-EGFP was a gift from Xiaokun Shu (Addgene plasmid # 87411 ; http://n2t.net/addgene:87411 ; RRID:Addgene_87411)
  • For your References section:

    Precision Optogenetic Tool for Selective Single- and Multiple-Cell Ablation in a Live Animal Model System. Makhijani K, To TL, Ruiz-Gonzalez R, Lafaye C, Royant A, Shu X. Cell Chem Biol. 2017 Jan 19;24(1):110-119. doi: 10.1016/j.chembiol.2016.12.010. Epub 2017 Jan 5. 10.1016/j.chembiol.2016.12.010 PubMed 28065655