-
Purposep15A plasmid expressing CasX locus from Deltaproteobacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Total vector size (bp) 5781
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCasX1
-
SpeciesDeltaproteobacteria
-
Insert Size (bp)2961
-
GenBank IDOGP07438.1
- Promoter None
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgccgatcaacgtAtcattttcg
- 3′ sequencing primer acgcagaaaggcccacccgaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCasX1 was a gift from Jennifer Doudna (Addgene plasmid # 87685 ; http://n2t.net/addgene:87685 ; RRID:Addgene_87685) -
For your References section:
New CRISPR-Cas systems from uncultivated microbes. Burstein D, Harrington LB, Strutt SC, Probst AJ, Anantharaman K, Thomas BC, Doudna JA, Banfield JF. Nature. 2016 Dec 22. doi: 10.1038/nature21059. 10.1038/nature21059 PubMed 28005056