pCZGY2141
(Plasmid
#87757)
-
PurposePcol-19-PH::miniSOG, expression of membrane targeted PH-miniSOG in epidermis.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGateway Final LR Clone
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 5252
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePcol-19-PH-miniSOG
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)2340
- Promoter Pcol-19
-
Tag
/ Fusion Protein
- PH
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgtaaaacgacggccagt
- 3′ sequencing primer caggaaacagctatgaccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2141 was a gift from Andrew Chisholm (Addgene plasmid # 87757 ; http://n2t.net/addgene:87757 ; RRID:Addgene_87757) -
For your References section:
Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG. Xu S, Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271. 10.1038/srep21271 PubMed 26861262