pCK302
(Plasmid #87768)

• Purpose: As pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be used
• Depositing Lab: John Heap
• Publication: Kelly et al ACS Synth Biol. 2016 Oct 21;5(10):1136-1145. Epub 2016 Jun 21.

Backbone

• Vector backbone: pJ404
• Backbone manufacturer: DNA2.0
• Backbone size w/o insert (bp): 3822
• Total vector size (bp): 5618
• Modifications to backbone: T5 promoter replaced with PrhaBAD-sfGFP, rhaS and its RBS placed downstream of ampR leading to constitutive expression of rhaS on plasmid.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PrhaBAD-sfGFP
• Alt name: rhamnose promoter
• Alt name: superfolder GFP
• Species: E. coli
• Insert Size (bp): 925
• Promoter: PrhaBAD rhamnose-inducible promoter from E. coli
• Tag / Fusion Protein:
  • 6xHis Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: gctcagtcgaaagactgggcctttcgc

Gene/Insert 2

• Gene/Insert name: rhaS from E. coli with its native RBS from E. coli
• Alt name: gene encoding transcriptional activator of the rhaBAD operon
• Species: E. coli
• Insert Size (bp): 871
• Promoter: ampR promoter on pJ404

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggttctcgcggtatcatcgc
• 3′ sequencing primer: attcaccaccctgaattgactctcttcc

Resource Information

• Supplemental Documents:
  • pCK302.gb
• A portion of this plasmid was derived from a plasmid made by: pJT118-sfGFP (Programming Microbes Using Pulse Width Modulation of Optical Signals Davidson, Eric A.; Basu, Amar S.; Bayer, Travis S. Journal of Molecular Biology (2013), 425 (22), 4161-4166 CODEN: JMOBAK; ISSN:0022-2836.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry