This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCK302
(Plasmid #87768)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87768 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJ404
  • Backbone manufacturer
    DNA2.0
  • Backbone size w/o insert (bp) 3822
  • Total vector size (bp) 5618
  • Modifications to backbone
    T5 promoter replaced with PrhaBAD-sfGFP, rhaS and its RBS placed downstream of ampR leading to constitutive expression of rhaS on plasmid.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PrhaBAD-sfGFP
  • Alt name
    rhamnose promoter
  • Alt name
    superfolder GFP
  • Species
    E. coli
  • Insert Size (bp)
    925
  • Promoter PrhaBAD rhamnose-inducible promoter from E. coli
  • Tag / Fusion Protein
    • 6xHis Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer gctcagtcgaaagactgggcctttcgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rhaS from E. coli with its native RBS from E. coli
  • Alt name
    gene encoding transcriptional activator of the rhaBAD operon
  • Species
    E. coli
  • Insert Size (bp)
    871
  • Promoter ampR promoter on pJ404

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggttctcgcggtatcatcgc
  • 3′ sequencing primer attcaccaccctgaattgactctcttcc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pJT118-sfGFP (Programming Microbes Using Pulse Width Modulation of Optical Signals Davidson, Eric A.; Basu, Amar S.; Bayer, Travis S. Journal of Molecular Biology (2013), 425 (22), 4161-4166 CODEN: JMOBAK; ISSN:0022-2836.)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCK302 was a gift from John Heap (Addgene plasmid # 87768 ; http://n2t.net/addgene:87768 ; RRID:Addgene_87768)
  • For your References section:

    Synthetic Chemical Inducers and Genetic Decoupling Enable Orthogonal Control of the rhaBAD Promoter. Kelly CL, Liu Z, Yoshihara A, Jenkinson SF, Wormald MR, Otero J, Estevez A, Kato A, Marqvorsen MH, Fleet GW, Estevez RJ, Izumori K, Heap JT. ACS Synth Biol. 2016 Oct 21;5(10):1136-1145. Epub 2016 Jun 21. 10.1021/acssynbio.6b00030 PubMed 27247275