pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
(Plasmid
#87803)
-
PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5137
- Total vector size (bp) 6632
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNLS
-
Alt namenuclear localization signal of SV40 large T antigen
-
SpeciesSynthetic
-
Insert Size (bp)21
-
GenBank IDnone
- Promoter CMV promoter, tetracycline operator
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAACGAGAAGCGCGATC
- 3′ sequencing primer GTCACCTTCAGCTTGGCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePTS1
-
Alt nameperoxisomal targeting signal 1
-
SpeciesSynthetic
-
Insert Size (bp)15
-
GenBank IDnone
- Promoter CMV promoter, tetracycline operator
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CAAGTTGGACATCACCTCCCAC
- 3′ sequencing primer CACCTACTCAGACAATGCGATG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
No stop codon should be placed at the 3' end of the first insert for proper co-expression using 2A-peptide.
Please cite: Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A (2017) CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Elife 6. doi: 10.7554/eLife.23352.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-EGFP-NLS-P2A-mCherry-PTS1 was a gift from Andrea Musacchio (Addgene plasmid # 87803 ; http://n2t.net/addgene:87803 ; RRID:Addgene_87803) -
For your References section:
CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A. Elife. 2017 Jan 6;6. pii: e23352. doi: 10.7554/eLife.23352. 10.7554/eLife.23352 PubMed 28059702