Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1
(Plasmid #87828)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87828 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5137
  • Total vector size (bp) 6695
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NLS
  • Alt name
    nuclear localization signal of SV40 large T antigen
  • Species
    Synthetic
  • Insert Size (bp)
    21
  • GenBank ID
    none
  • Promoter CMV promoter, tetracycline operator
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAACGAGAAGCGCGATC
  • 3′ sequencing primer GTCACCTTCAGCTTGGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PTS1
  • Alt name
    peroxisomal targeting signal 1
  • Species
    Synthetic
  • Insert Size (bp)
    15
  • GenBank ID
    none
  • Promoter CMV promoter, tetracycline operator
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CAAGTTGGACATCACCTCCCAC
  • 3′ sequencing primer CACCTACTCAGACAATGCGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

No stop codon should be placed at the 3' end of the first insert for proper co-expression using 2A-peptide. Tandem 2A-peptide, P2AT2A, enables high-effecient separation of EGFP-tagged protein and mCherry-tagged protein compared to single 2A-peptides, P2A or T2A.

Please cite: Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A (2017) CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Elife 6. doi: 10.7554/eLife.23352.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1 was a gift from Andrea Musacchio (Addgene plasmid # 87828 ; http://n2t.net/addgene:87828 ; RRID:Addgene_87828)
  • For your References section:

    CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading. Pan D, Klare K, Petrovic A, Take A, Walstein K, Singh P, Rondelet A, Bird AW, Musacchio A. Elife. 2017 Jan 6;6. pii: e23352. doi: 10.7554/eLife.23352. 10.7554/eLife.23352 PubMed 28059702