pFUGW-ZipACR-EYFP
(Plasmid
#88844)
-
PurposeFast anion channelrhodopsin (current half-decay time 2-4 ms depending on voltage) for time-resolved inhibition of neuronal spiking
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 88844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 3099
- Total vector size (bp) 4757
-
Modifications to backboneNone
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZipACR-NotI-EYFP
-
SpeciesProteomonas sulcata
-
Insert Size (bp)1658
-
GenBank IDKX879679 KX879679
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGAACTATGCGCTCGGGGTTGGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-ZipACR-EYFP was a gift from John Spudich (Addgene plasmid # 88844 ; http://n2t.net/addgene:88844 ; RRID:Addgene_88844) -
For your References section:
The Expanding Family of Natural Anion Channelrhodopsins Reveals Large Variations in Kinetics, Conductance, and Spectral Sensitivity. Govorunova EG, Sineshchekov OA, Rodarte EM, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. Sci Rep. 2017 Mar 3;7:43358. doi: 10.1038/srep43358. 10.1038/srep43358 PubMed 28256618