Skip to main content

pAPM sh2 DNMT1
(Plasmid #88885)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 88885 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAPM
  • Backbone size w/o insert (bp) 7505
  • Total vector size (bp) 7617
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA no.2 DNMT1
  • gRNA/shRNA sequence
    AAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCACAAACGCTCTCATCGACAAGT GTGACGTCGAAGACTCCTGACTTGTCGATGAGAGCGTTTGTATGCCTACTGCCTCGGAAT TCAAGGGGCT
  • Species
    M. musculus (mouse)
  • Promoter SFFV (spleen focus forming virus)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGTTTATTACAGGGACAGCAGAG
  • 3′ sequencing primer CCACCGGTATCGATACGCGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAPM sh2 DNMT1 was a gift from Silvia Monticelli (Addgene plasmid # 88885 ; http://n2t.net/addgene:88885 ; RRID:Addgene_88885)
  • For your References section:

    Dnmt3a restrains mast cell inflammatory responses. Leoni C, Montagner S, Rinaldi A, Bertoni F, Polletti S, Balestrieri C, Monticelli S. Proc Natl Acad Sci U S A. 2017 Feb 6. pii: 201616420. doi: 10.1073/pnas.1616420114. 10.1073/pnas.1616420114 PubMed 28167789