MSCV Puro SCRIB P305L
(Plasmid
#88887)
-
PurposeSCRIB - Proline to Lysine mutation at 305 a.a. in MSCV backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 88887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV
- Backbone size w/o insert (bp) 6
- Total vector size (bp) 11330
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSCRIB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5
-
MutationProline to Leucine mutation @ 305th amino acid
-
GenBank IDNM_182706
-
Entrez GeneSCRIB (a.k.a. CRIB1, SCRB1, SCRIB1, Vartul, oSCRIB)
- Promoter MSCV promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWeiyue Zhang - University Health Network (UHN) @ The Princess Margaret Cancer Center
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV Puro SCRIB P305L was a gift from Senthil Muthuswamy (Addgene plasmid # 88887 ; http://n2t.net/addgene:88887 ; RRID:Addgene_88887) -
For your References section:
An interaction between Scribble and the NADPH oxidase complex controls M1 macrophage polarization and function. Zheng W, Umitsu M, Jagan I, Tran CW, Ishiyama N, BeGora M, Araki K, Ohashi PS, Ikura M, Muthuswamy SK. Nat Cell Biol. 2016 Nov;18(11):1244-1252. doi: 10.1038/ncb3413. Epub 2016 Oct 3. 10.1038/ncb3413 PubMed 27694890