Skip to main content

pT7-VP7SA11
(Plasmid #89167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89167 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p3E5
  • Backbone size w/o insert (bp) 3074
  • Total vector size (bp) 4137
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rotavirus SA11 VP7
  • Species
    Rotavirus SA11
  • Insert Size (bp)
    1063
  • GenBank ID
    LC178569
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • *see below

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer T7 forward CTGTGGATAACCGTATTACCG
  • 3′ sequencing primer T7 terminal GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note: Addgene's quality control sequencing finds a K180E amino acid residue substitution. The depositing laboratory is aware of this residue change.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-VP7SA11 was a gift from Takeshi Kobayashi (Addgene plasmid # 89167 ; http://n2t.net/addgene:89167 ; RRID:Addgene_89167)
  • For your References section:

    Entirely plasmid-based reverse genetics system for rotaviruses. Kanai Y, Komoto S, Kawagishi T, Nouda R, Nagasawa N, Onishi M, Matsuura Y, Taniguchi K, Kobayashi T. Proc Natl Acad Sci U S A. 2017 Jan 30. pii: 201618424. doi: 10.1073/pnas.1618424114. 10.1073/pnas.1618424114 PubMed 28137864