Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTX200
(Plasmid #89264)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89264 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTX172
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsYSA-gRNA01
  • gRNA/shRNA sequence
    GCGCGCCACCTCGGCCGAAG
  • Insert Size (bp)
    20
  • Promoter Maize Ubiquitin1 promoter
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 3′ sequencing primer ZY065-RB: TTCTAATAAACGCTCTTTTCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTX200 was a gift from Daniel Voytas (Addgene plasmid # 89264 ; http://n2t.net/addgene:89264 ; RRID:Addgene_89264)
  • For your References section:

    A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. 10.1016/j.molp.2016.05.001 PubMed 27212389