pMIG-W-Flag-Nbs1
(Plasmid
#89315)
-
Purposeretroviral expression of mouse Nbs1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMIG-W
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNbs1
-
SpeciesM. musculus (mouse)
-
Entrez GeneNbn (a.k.a. Nbs1)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGTCTCTCCCCCTTGAACCTCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Flag tagged mNbs1 (2-751aa)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG-W-Flag-Nbs1 was a gift from John Petrini (Addgene plasmid # 89315 ; http://n2t.net/addgene:89315 ; RRID:Addgene_89315) -
For your References section:
The Mre11-Nbs1 Interface Is Essential for Viability and Tumor Suppression. Kim JH, Grosbart M, Anand R, Wyman C, Cejka P, Petrini JH. Cell Rep. 2017 Jan 10;18(2):496-507. doi: 10.1016/j.celrep.2016.12.035. 10.1016/j.celrep.2016.12.035 PubMed 28076792