Skip to main content

E1b-GFP-Tol2-Gateway dre SE-irf2bpl B
(Plasmid #89371)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89371 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    E1b-GFP-Tol2-Gateway
  • Backbone manufacturer
    Nadav Ahituv lab
  • Total vector size (bp) 10860
  • Modifications to backbone
    Insertion of super-enhancer region

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    irf2bpl
  • Alt name
    super-enhancer irf2bpl
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1533
  • Entrez Gene
    irf2bpl (a.k.a. wu:fc39d10, wu:fj46f11, zgc:73290, zgc:77204)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGAACCGAACATGAAGTTTGGC
  • 3′ sequencing primer CTGGGTCAGTTGGCGTTCAGTTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E1b-GFP-Tol2-Gateway dre SE-irf2bpl B was a gift from Alena Shkumatava (Addgene plasmid # 89371 ; http://n2t.net/addgene:89371 ; RRID:Addgene_89371)
  • For your References section:

    Comparative analyses of super-enhancers reveal conserved elements in vertebrate genomes. Perez-Rico YA, Boeva V, Mallory AC, Bitetti A, Majello S, Barillot E, Shkumatava A. Genome Res. 2017 Feb;27(2):259-268. doi: 10.1101/gr.203679.115. Epub 2016 Dec 13. 10.1101/gr.203679.115 PubMed 27965291