This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl F
(Plasmid #89375)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 89375 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Nadav Ahituv lab
  • Total vector size (bp) 11944

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    super-enhancer Irf2bpl
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Irf2bpl (a.k.a. 6430527G18Rik, Eap1)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCGCTTGCCACCATGTT
  • 3′ sequencing primer GTGCTTGTCGTACAGTTCGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl F was a gift from Alena Shkumatava (Addgene plasmid # 89375 ; ; RRID:Addgene_89375)
  • For your References section:

    Comparative analyses of super-enhancers reveal conserved elements in vertebrate genomes. Perez-Rico YA, Boeva V, Mallory AC, Bitetti A, Majello S, Barillot E, Shkumatava A. Genome Res. 2017 Feb;27(2):259-268. doi: 10.1101/gr.203679.115. Epub 2016 Dec 13. 10.1101/gr.203679.115 PubMed 27965291