GFP-Rab27B Q78L
(Plasmid
#89448)
-
PurposeExpression of GFP-tagged human Rab27B Q78L in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5350
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Rab27B Q78L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)650
-
MutationQ78L
-
GenBank IDXM_017025913.1
-
Entrez GeneRAB27B (a.k.a. C25KG)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Rab27B Q78L was a gift from Wendy Westbroek (Addgene plasmid # 89448 ; http://n2t.net/addgene:89448 ; RRID:Addgene_89448) -
For your References section:
Effect of the secretory small GTPase Rab27B on breast cancer growth, invasion, and metastasis. Hendrix A, Maynard D, Pauwels P, Braems G, Denys H, Van den Broecke R, Lambert J, Van Belle S, Cocquyt V, Gespach C, Bracke M, Seabra MC, Gahl WA, De Wever O, Westbroek W. J Natl Cancer Inst. 2010 Jun 16;102(12):866-80. doi: 10.1093/jnci/djq153. Epub 2010 May 18. 10.1093/jnci/djq153 PubMed 20484105