Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p426TEF-LptTPS-A
(Plasmid #89468)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89468 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p426-TEF
  • Backbone manufacturer
    DualSystems Biotech
  • Backbone size w/o insert (bp) 6352
  • Total vector size (bp) 7384
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LptTPS-A
  • Alt name
    Prespatane synthase (S.cerevisiae-codon optimized gene)
  • Species
    Laurencia pacifica-symbiont
  • Insert Size (bp)
    1026
  • Promoter pBR322 origin of replication for propagation in E. coli
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACTTCTTGCTCATTAGAAAGA
  • 3′ sequencing primer T7 term
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Vector features: TEF1 - S. cerevisiae TEF1 promoter URA3 - URA3 auxotrophic marker 2micron - 2micron origin of replication for propagation in S. cerevisiae AmpR - Beta lactamase gene encoding ampicillin resistance pBBR322 ori - pBR322 origin of replication for propagation in E. coli

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426TEF-LptTPS-A was a gift from Jing-Ke Weng (Addgene plasmid # 89468 ; http://n2t.net/addgene:89468 ; RRID:Addgene_89468)