p426TEF-LptTPS-A
(Plasmid #89468)

• Purpose: Expression of prespatane synthase LptTPS-A in S. cerevisiae for sesquiterpene production
• Depositing Lab: Jing-Ke Weng
• Publication: Prespatane synthase yeast expression plasmid (unpublished)

Backbone

• Vector backbone: p426-TEF
• Backbone manufacturer: DualSystems Biotech
• Backbone size w/o insert (bp): 6352
• Total vector size (bp): 7384
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LptTPS-A
• Alt name: Prespatane synthase (S.cerevisiae-codon optimized gene)
• Species: Laurencia pacifica-symbiont
• Insert Size (bp): 1026
• Promoter: pBR322 origin of replication for propagation in E. coli
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACTTCTTGCTCATTAGAAAGA
• 3′ sequencing primer: T7 term

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector features: TEF1 - S. cerevisiae TEF1 promoter URA3 - URA3 auxotrophic marker 2micron - 2micron origin of replication for propagation in S. cerevisiae AmpR - Beta lactamase gene encoding ampicillin resistance pBBR322 ori - pBR322 origin of replication for propagation in E. coli