p426TEF-LptTPS-A
(Plasmid
#89468)
-
PurposeExpression of prespatane synthase LptTPS-A in S. cerevisiae for sesquiterpene production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep426-TEF
-
Backbone manufacturerDualSystems Biotech
- Backbone size w/o insert (bp) 6352
- Total vector size (bp) 7384
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLptTPS-A
-
Alt namePrespatane synthase (S.cerevisiae-codon optimized gene)
-
SpeciesLaurencia pacifica-symbiont
-
Insert Size (bp)1026
- Promoter pBR322 origin of replication for propagation in E. coli
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACTTCTTGCTCATTAGAAAGA
- 3′ sequencing primer T7 term (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector features: TEF1 - S. cerevisiae TEF1 promoter URA3 - URA3 auxotrophic marker 2micron - 2micron origin of replication for propagation in S. cerevisiae AmpR - Beta lactamase gene encoding ampicillin resistance pBBR322 ori - pBR322 origin of replication for propagation in E. coli
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426TEF-LptTPS-A was a gift from Jing-Ke Weng (Addgene plasmid # 89468 ; http://n2t.net/addgene:89468 ; RRID:Addgene_89468)