Skip to main content
Addgene

GFP-hChibby1
(Plasmid #89472)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89472 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Chibby1
  • Species
    H. sapiens (human)
  • Entrez Gene
    CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ACCACATGGTCCTTCTTCAG
  • 3′ sequencing primer TTATGCTGAGTGATATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A human Chibby1 cDNA including its 3' UTR was subcloned into the V8 BB.GFPLT CS2+ vector (Addgene plasmid #17099).

The insert can be sequenced using the following primers: forward (GFP primer), ACCACATGGTCCTTCTTCAG;
reverse (T7 primer), TTATGCTGAGTGATATC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-hChibby1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89472 ; http://n2t.net/addgene:89472 ; RRID:Addgene_89472)