Skip to main content

pLKO-FOXM1-shRNA-84
(Plasmid #89494)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89494 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO
  • Total vector size (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FOXM1
  • gRNA/shRNA sequence
    TTGCAGGGTGGTCCGTGTAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    FOXM1 (a.k.a. FKHL16, FOXM1A, FOXM1B, FOXM1C, HFH-11, HFH11, HNF-3, INS-1, MPHOSPH2, MPP-2, MPP2, PIG29, TRIDENT)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The FOXM1 shRNA (TRCN0000273984) sequence was retrieved from the Broad Genetic Perturbation Platform Web Portal. Oligos corresponding to the shRNA were annealed and ligated into pLKO-puro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-FOXM1-shRNA-84 was a gift from Adam Karpf (Addgene plasmid # 89494 ; http://n2t.net/addgene:89494 ; RRID:Addgene_89494)