AAV-syn-ChR2-Kv-P2A-H2b-mRuby2
(Plasmid
#89570)
-
PurposeChannelrhodopsin localized to neuronal soma with simultaneous nuclear labeling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4548
- Total vector size (bp) 6944
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin
-
Alt nameChR2
-
Insert Size (bp)1137
-
MutationH134R
- Promoter synapsin
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atggactatggcggcgctttgtctgccg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHistone 2B
-
Alt nameH2B
-
Alt namehist1h2bb
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1151
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgttaaagcaagcaggagacgtggaagaaaaccccggtcctggttctATGCCAGAGCCAGCGAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-syn-ChR2-Kv-P2A-H2b-mRuby2 was a gift from McLean Bolton (Addgene plasmid # 89570 ; http://n2t.net/addgene:89570 ; RRID:Addgene_89570) -
For your References section:
Cellular resolution circuit mapping with temporal-focused excitation of soma-targeted channelrhodopsin. Baker CA, Elyada YM, Parra A, Bolton MM. Elife. 2016 Aug 15;5. pii: e14193. doi: 10.7554/eLife.14193. 10.7554/eLife.14193 PubMed 27525487