AAV-syn-ChR2-Kv-P2A-H2b-mRuby2
(Plasmid
#89570)
-
PurposeChannelrhodopsin localized to neuronal soma with simultaneous nuclear labeling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4548
- Total vector size (bp) 6944
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin
-
Alt nameChR2
-
Insert Size (bp)1137
-
MutationH134R
- Promoter synapsin
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atggactatggcggcgctttgtctgccg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHistone 2B
-
Alt nameH2B
-
Alt namehist1h2bb
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1151
-
Tag
/ Fusion Protein
- mRuby2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgttaaagcaagcaggagacgtggaagaaaaccccggtcctggttctATGCCAGAGCCAGCGAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-syn-ChR2-Kv-P2A-H2b-mRuby2 was a gift from McLean Bolton (Addgene plasmid # 89570 ; http://n2t.net/addgene:89570 ; RRID:Addgene_89570) -
For your References section:
Cellular resolution circuit mapping with temporal-focused excitation of soma-targeted channelrhodopsin. Baker CA, Elyada YM, Parra A, Bolton MM. Elife. 2016 Aug 15;5. pii: e14193. doi: 10.7554/eLife.14193. 10.7554/eLife.14193 PubMed 27525487