pEF6 rglut1 flag complete
(Plasmid
#89571)
-
Purposerglut1 flag complete
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerglut1 flag complete
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSlc2a1 (a.k.a. GLUTB, GTG1, Glut1, Gtg3, RATGTG1)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- Exo Facial
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF6 rglut1 flag complete was a gift from Jeffrey Rathmell (Addgene plasmid # 89571 ; http://n2t.net/addgene:89571 ; RRID:Addgene_89571) -
For your References section:
An essential role for the Glut1 PDZ-binding motif in growth factor regulation of Glut1 degradation and trafficking. Wieman HL, Horn SR, Jacobs SR, Altman BJ, Kornbluth S, Rathmell JC. Biochem J. 2009 Mar 1;418(2):345-67. doi: 10.1042/BJ20081422. 10.1042/BJ20081422 PubMed 19016655