pEF6 rglut1 flag complete
(Plasmid
#89571)
-
Purposerglut1 flag complete
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89571-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89571-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerglut1 flag complete
-
SpeciesR. norvegicus (rat)
-
Entrez GeneSlc2a1 (a.k.a. GLUTB, GTG1, Glut1, Gtg3, RATGTG1)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- Exo Facial
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89571-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89571-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF6 rglut1 flag complete was a gift from Jeffrey Rathmell (Addgene plasmid # 89571 ; http://n2t.net/addgene:89571 ; RRID:Addgene_89571) -
For your References section:
An essential role for the Glut1 PDZ-binding motif in growth factor regulation of Glut1 degradation and trafficking. Wieman HL, Horn SR, Jacobs SR, Altman BJ, Kornbluth S, Rathmell JC. Biochem J. 2009 Mar 1;418(2):345-67. doi: 10.1042/BJ20081422. 10.1042/BJ20081422 PubMed 19016655