Skip to main content

pET22b-csgA
(Plasmid #89581)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89581 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-22b(+)
  • Backbone size w/o insert (bp) 5405
  • Total vector size (bp) 5927
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    csgA
  • Alt name
    major curli subunit
  • Insert Size (bp)
    552
  • Entrez Gene
    csgA (a.k.a. b1042, ECK1028)
  • Tags / Fusion Proteins
    • 3xGGSG linker - TEV site - 3xGGSG linker (C terminal on insert)
    • 6xHis tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b-csgA was a gift from Urartu Seker (Addgene plasmid # 89581 ; http://n2t.net/addgene:89581 ; RRID:Addgene_89581)
  • For your References section:

    Genetically-Tunable Mechanical Properties of Bacterial Functional Amyloid Nanofibers. Abdelwahab MT, Kalyoncu E, Onur T, Baykara MZ, Seker UO. Langmuir. 2017 Apr 7. doi: 10.1021/acs.langmuir.7b00112. 10.1021/acs.langmuir.7b00112 PubMed 28388843