pCCLc-U6-shHMGA2.2-PGK-dTomato
(Plasmid
#89605)
-
PurposeSilencing Hmga2 in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCCLc
-
Backbone manufacturerLuigi Naldini, PMID 9765382
- Backbone size w/o insert (bp) 8661
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersdTomato
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting HMGA2
-
gRNA/shRNA sequenceAAAAAAGGGAAGAGGAGGAGGAATTTTTCTCTTGGTAAAATTCCTCC TCCTCTTCCCGGTGTTTCGTCCTTTCCACAAG
-
SpeciesH. sapiens (human)
-
Entrez GeneHMGA2 (a.k.a. BABL, HMGI-C, HMGIC, LIPO, SRS5, STQTL9)
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCLc-U6-shHMGA2.2-PGK-dTomato was a gift from Fernando Fierro (Addgene plasmid # 89605 ; http://n2t.net/addgene:89605 ; RRID:Addgene_89605) -
For your References section:
Fibroblast Growth Factor 2 Regulates High Mobility Group A2 Expression in Human Bone Marrow-Derived Mesenchymal Stem Cells. Kalomoiris S, Cicchetto AC, Lakatos K, Nolta JA, Fierro FA. J Cell Biochem. 2016 Sep;117(9):2128-37. doi: 10.1002/jcb.25519. Epub 2016 Mar 8. 10.1002/jcb.25519 PubMed 26888666