pX335A_hCas9(D10A)_IRF8gRNA3
(Plasmid
#89721)
-
PurposeKnockout IRF8 in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
-
Backbone manufacturerFeng Zhang lab, modified by Boris Greber lab
- Backbone size w/o insert (bp) 10827
- Total vector size (bp) 10829
-
Modifications to backbone1. Puromycin resistance-2A-GFP cassette (previously introduced by Boris Greber lab) 2. IRF8 gRNA3
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIRF8 gRNA3
-
gRNA/shRNA sequencehuman IRF8 locus (Intron 2 - Exon 3 boundary)
-
SpeciesH. sapiens (human)
-
GenBank ID3394
-
Entrez GeneIRF8 (a.k.a. H-ICSBP, ICSBP, ICSBP1, IMD32A, IMD32B, IRF-8)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer actatcatatgcttaccgtaac
- 3′ sequencing primer aacgccaatagggactttcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original vector from Feng Zhang lab (pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Plasmid #42335) was modified from Boris Greber lab with a Puromycin resistance-2A-GFP cassette (Zhang M, D'Aniello C, Verkerk AO et al. Recessive cardiac phenotypes in induced pluripotent stem cell models of Jervell and Lange-Nielsen syndrome: disease mechanisms and pharmacological rescue. Proc Natl Acad Sci USA 2014;111:E5383-E5392.).
This backbone was used for IRF8 gRNA cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335A_hCas9(D10A)_IRF8gRNA3 was a gift from Martin Zenke (Addgene plasmid # 89721 ; http://n2t.net/addgene:89721 ; RRID:Addgene_89721) -
For your References section:
Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Sontag S, Forster M, Qin J, Wanek P, Mitzka S, Schuler HM, Koschmieder S, Rose-John S, Sere K, Zenke M. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565. 10.1002/stem.2565 PubMed 28090699