Skip to main content

hZMPSTE24-3FLAG_pQCXIP
(Plasmid #89759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89759 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7159
  • Total vector size (bp) 8674
  • Modifications to backbone
    Insert cloned into AgeI and BamHI sites of pQCXIP backbone. [Agei - Kozak seq (ACC) - ZMPSTE24 CDS (1425bp) - 9bp (NotI spacer) - 3xFLAG epitopes - STOP codon].
  • Vector type
    Mammalian Expression, Retroviral ; Bicistronic expression: puromycin resistance transcript is downstream
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    This gene sometimes gives low DNA yields.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Homo sapiens zinc metallopeptidase STE24 (ZMPSTE24)
  • Alt name
    ZMPSTE24; HGPS; PRO1; FACE1; STE24; FACE-1; Ste24p
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1425
  • Mutation
    Y253H in ZMPSTE24 (see depositor comments below)
  • GenBank ID
    BC037283
  • Entrez Gene
    ZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
  • Promoter CMV
  • Tags / Fusion Proteins
    • non coding ACC Kozak sequence before ATG protein initiation (N terminal on backbone)
    • 9bp spacer (NotI site) - 3xFLAG epitopes - Stop codon (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA clone MGC:33086 IMAGE:5269064

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reverse primer gives poor quality sequence data due to intervening difficult sequence. ZMPSTE24 construct containing a Y253H mutation was used in our published experiments.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hZMPSTE24-3FLAG_pQCXIP was a gift from Martin Dorf (Addgene plasmid # 89759 ; http://n2t.net/addgene:89759 ; RRID:Addgene_89759)
  • For your References section:

    ZMPSTE24 defends against influenza and other pathogenic viruses. Fu B, Wang L, Li S, Dorf ME. J Exp Med. 2017 Feb 28. pii: jem.20161270. doi: 10.1084/jem.20161270. 10.1084/jem.20161270 PubMed 28246125