pCrysβ:ECFP-LexOP:mCherry-NRasQ61K
(Plasmid
#89886)
-
PurposeHuman NRasQ61K fused to mCherry downstream of LexOP, placed within a non-autonomous maize dissociation (Ds) element for integration in zebrafish. Contains pCrysB-ECFP for screening.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDs(cry:ECFP-LexOP:Cherry)
- Backbone size w/o insert (bp) 6280
- Total vector size (bp) 7585
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-NRasQ61K
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGACTCTAGGATCTTCGCA
- 3′ sequencing primer GGGAGGTGTGGGAGGTTTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypBabe-NRas 61K (plasmid #12543; Addgene) pDs(cry:ECFP-LexOP:Cherry) construct was from Dr Alexander Emelyanov and Dr Sergey Parinov
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCrysβ:ECFP-LexOP:mCherry-NRasQ61K was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 89886 ; http://n2t.net/addgene:89886 ; RRID:Addgene_89886) -
For your References section:
Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124