Skip to main content
Addgene

pMT2 Cav2.2 DomI and DomII
(Plasmid #89891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89891 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone size w/o insert (bp) 5129
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cacna1b
  • Alt name
    Alpha1B
  • Insert Size (bp)
    3505
  • Mutation
    Stop codon after amino acid 1154 (this is a truncated form of the wild type gene)
  • Entrez Gene
    CACNA1B
  • Promoter adenovirus major late promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
  • 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains Cav2.2 N-terminus, Domain I, the I-II loop, Domain II and the II-III loop.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT2 Cav2.2 DomI and DomII was a gift from Annette Dolphin (Addgene plasmid # 89891 ; http://n2t.net/addgene:89891 ; RRID:Addgene_89891)
  • For your References section:

    Dominant-negative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs. Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, Dolphin AC. J Neurosci. 2001 Nov 1;21(21):8495-504. 21/21/8495 [pii] PubMed 11606638