Skip to main content

pMT2 Beta1b GFP
(Plasmid #89893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89893 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone size w/o insert (bp) 5129
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cacnb1
  • Alt name
    Beta1b
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2662
  • Mutation
    GFP sequence inserted just before the Stop codon
  • Entrez Gene
    Cacnb1 (a.k.a. CAB1)
  • Promoter adenovirus major late promoter
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
  • 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT2 Beta1b GFP was a gift from Annette Dolphin (Addgene plasmid # 89893 ; http://n2t.net/addgene:89893 ; RRID:Addgene_89893)
  • For your References section:

    The CaVbeta Subunit Protects the I-II Loop of the Voltage-gated Calcium Channel CaV2.2 from Proteasomal Degradation but Not Oligoubiquitination. Page KM, Rothwell SW, Dolphin AC. J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3. 10.1074/jbc.M116.737270 PubMed 27489103

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More