pMT2 Beta1b GFP
(Plasmid
#89893)
-
PurposeMammalian expression of Beta1b GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMT2
- Backbone size w/o insert (bp) 5129
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCacnb1
-
Alt nameBeta1b
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2662
-
MutationGFP sequence inserted just before the Stop codon
-
Entrez GeneCacnb1 (a.k.a. CAB1)
- Promoter adenovirus major late promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
- 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT2 Beta1b GFP was a gift from Annette Dolphin (Addgene plasmid # 89893 ; http://n2t.net/addgene:89893 ; RRID:Addgene_89893) -
For your References section:
The CaVbeta Subunit Protects the I-II Loop of the Voltage-gated Calcium Channel CaV2.2 from Proteasomal Degradation but Not Oligoubiquitination. Page KM, Rothwell SW, Dolphin AC. J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3. 10.1074/jbc.M116.737270 PubMed 27489103