Skip to main content
Addgene

pcDNA3.1+(rInsp)-Ins-GLuc
(Plasmid #89928)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89928 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+rInsp
  • Backbone manufacturer
    Invitrogen (CMV removed)
  • Backbone size w/o insert (bp) 5091
  • Total vector size (bp) 5965
  • Modifications to backbone
    CMV promoter was excised using MluI/NheI digest and rat Insulin II promoter was inserted at the same sites.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human insulin-Gaussia-Luciferase
  • Alt name
    hIns-GLuc
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    849
  • Mutation
    DNA sequence for Gaussia luciferase was humanized and two mutations (M43I/M110I) were made to enhance glow-like kinetics.
  • Entrez Gene
    INS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)
  • Promoter rat Insulin II promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GTCGACGGATCGGGAGAT
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GeneArt Gene Synthesis (Life Technologies) was used to assemble human insulin with humanized Gaussia luciferase inserted into the C-peptide.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+(rInsp)-Ins-GLuc was a gift from Melanie Cobb (Addgene plasmid # 89928 ; http://n2t.net/addgene:89928 ; RRID:Addgene_89928)
  • For your References section:

    Insulin promoter-driven Gaussia luciferase-based insulin secretion biosensor assay for discovery of beta-cell glucose-sensing pathways. Kalwat MA, Wichaidit C, Nava Garcia AY, McCoy MK, McGlynn K, Hwang IH, MacMillan JB, Posner BA, Cobb MH. ACS Sens. 2016 Oct 28;1(10):1208-1212. Epub 2016 Oct 12. 10.1021/acssensors.6b00433 PubMed 27819058