Skip to main content
Holiday Schedule: Addgene will be closed December 23 - December 30. Order processing and shipping will resume on January 2, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89932)


Item Catalog # Description Quantity Price (USD)
Plasmid 89932 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4156
  • Total vector size (bp) 5023
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Insert Size (bp)
  • Mutation
    M.SssI residues 2-272 fragment
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGG
  • 3′ sequencing primer gcttgccaaacctacaggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Does not contain active methylatransferase - general cloning strains can be used.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV MN (eGFP) was a gift from Carl Novina (Addgene plasmid # 89932 ; ; RRID:Addgene_89932)
  • For your References section:

    Targeted DNA methylation in human cells using engineered dCas9-methyltransferases. Xiong T, Meister GE, Workman RE, Kato NC, Spellberg MJ, Turker F, Timp W, Ostermeier M, Novina CD. Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0. 10.1038/s41598-017-06757-0 [pii] PubMed 28751638