pBAD-LSSmCherry1
(Plasmid #89986)

• Purpose: Long stokes-shift variant of red fluorescent protein mCherry
• Depositing Lab: Robert Campbell
• Publication: Shen et al PLoS One. 2017 Feb 27;12(2):e0171257. doi: 10.1371/journal.pone.0171257. eCollection 2017.

Backbone

• Vector backbone: pBAD His B
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LSSmCherry1
• Alt name: Long Stokes-shift mCherry
• Species: Synthetic
• Insert Size (bp): 711
• GenBank ID: KX638424.1
• Tag / Fusion Protein:
  • 6xHis-T7-Xpress

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Supplemental Documents:
  • LSSmCherry1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry