Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBAD-LSSmCherry1
(Plasmid #89986)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89986 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSSmCherry1
  • Alt name
    Long Stokes-shift mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • GenBank ID
    KX638424.1
  • Tag / Fusion Protein
    • 6xHis-T7-Xpress

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-LSSmCherry1 was a gift from Robert Campbell (Addgene plasmid # 89986)
  • For your References section:

    Engineering of mCherry variants with long Stokes shift, red-shifted fluorescence, and low cytotoxicity. Shen Y, Chen Y, Wu J, Shaner NC, Campbell RE. PLoS One. 2017 Feb 27;12(2):e0171257. doi: 10.1371/journal.pone.0171257. eCollection 2017. PONE-D-16-30422 [pii] PubMed 28241009