pLKO.1-shDsup
(Plasmid
#90024)
-
PurposeTo establish Dsup knock down cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 puro
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDsup
-
Alt nameLC050827
-
gRNA/shRNA sequenceACCGGTGAACGTAACCGTTACCAAAGGTTCAAGAGACCTTTGGTAACGGTTACGTTCTTTTTGAATTC
-
SpeciesRamazzottius varieornatus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert species is Ramazzottius varieornatus
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-shDsup was a gift from Takekazu Kunieda (Addgene plasmid # 90024 ; http://n2t.net/addgene:90024 ; RRID:Addgene_90024) -
For your References section:
Extremotolerant tardigrade genome and improved radiotolerance of human cultured cells by tardigrade-unique protein. Hashimoto T, Horikawa DD, Saito Y, Kuwahara H, Kozuka-Hata H, Shin-I T, Minakuchi Y, Ohishi K, Motoyama A, Aizu T, Enomoto A, Kondo K, Tanaka S, Hara Y, Koshikawa S, Sagara H, Miura T, Yokobori S, Miyagawa K, Suzuki Y, Kubo T, Oyama M, Kohara Y, Fujiyama A, Arakawa K, Katayama T, Toyoda A, Kunieda T. Nat Commun. 2016 Sep 20;7:12808. doi: 10.1038/ncomms12808. 10.1038/ncomms12808 PubMed 27649274