Skip to main content

LP346
(Plasmid #90175)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90175 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 7700
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KIF13B
  • Alt name
    GAKIN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3000
  • Mutation
    aa residues 1-1000
  • GenBank ID
    NM_015254.3
  • Entrez Gene
    KIF13B (a.k.a. GAKIN)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer EGFP-C: CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R: GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert PCR-amplified from plasmid received from Dr. Athar Chishti, Tufts University School of Medicine (pEGFP-C1 with full-length GAKIN/KIF13B; Asaba et al. J. Biol. Chem. 2003, PMID: 12496241).

Addgene's sequencing results found a D813Y mutation in KIF13B compared to the reference sequence NM_015254.3. This residue is not conserved in kinesin-3 motors and is unlikely to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LP346 was a gift from Lotte Pedersen (Addgene plasmid # 90175 ; http://n2t.net/addgene:90175 ; RRID:Addgene_90175)
  • For your References section:

    KIF13B establishes a CAV1-enriched microdomain at the ciliary transition zone to promote Sonic hedgehog signalling. Schou KB, Mogensen JB, Morthorst SK, Nielsen BS, Aleliunaite A, Serra-Marques A, Furstenberg N, Saunier S, Bizet AA, Veland IR, Akhmanova A, Christensen ST, Pedersen LB. Nat Commun. 2017 Jan 30;8:14177. doi: 10.1038/ncomms14177. 10.1038/ncomms14177 PubMed 28134340